View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11880_high_28 (Length: 270)

Name: NF11880_high_28
Description: NF11880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11880_high_28
NF11880_high_28
[»] chr4 (2 HSPs)
chr4 (20-138)||(26691313-26691431)
chr4 (235-267)||(26691185-26691217)


Alignment Details
Target: chr4 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 20 - 138
Target Start/End: Complemental strand, 26691431 - 26691313
Alignment:
20 gagaatcactaatcatgtagctatatttttagtatttgcaactctcattgtttataatacattaatgcttatttttcatattaaattgaagaggatgtac 119  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26691431 gagaatcaccaatcatgtagctatatttttagtatttgcaactctcattgtttataatacattaatgcttatttttcatattaaattgaagaggatgtac 26691332  T
120 ttgccctcccttacctata 138  Q
    |||||||||||||||||||    
26691331 ttgccctcccttacctata 26691313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 235 - 267
Target Start/End: Complemental strand, 26691217 - 26691185
Alignment:
235 gatttttcaattattgaaagaatgcattcatct 267  Q
    |||||||||||||||||||||||||||||||||    
26691217 gatttttcaattattgaaagaatgcattcatct 26691185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University