View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11880_low_29 (Length: 325)
Name: NF11880_low_29
Description: NF11880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11880_low_29 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 277; Significance: 1e-155; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 18 - 314
Target Start/End: Original strand, 5394956 - 5395251
Alignment:
| Q |
18 |
gtttgtgcatatgggaaaattgcaccattatttattcaccaaaataaaatagttacggaaccaaaatattaacttttcacaaacacctaatttataccat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5394956 |
gtttgtgcatatgggaaaattgcaccattatttattcaccaaaataaaatagctacggaaccaaaatattaacttttcacaaacacctaatttataccat |
5395055 |
T |
|
| Q |
118 |
aagcaacatcactcttgccagctgaacccgcagacaccctctctctgcagggtccaccttgtgaaaacaaacacctcaactcattcacggcgcacataca |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5395056 |
aagcaacatcactcttgccagctgaacccgcagacaccc-ctctctgcagggtccaccttgtgaaaacaaacacctcaactcattcacggcgcacataca |
5395154 |
T |
|
| Q |
218 |
ttatgcgacttggatttgcacattcatcctttccatcatgttctctcttcactttgttcttggatctgcagttagcatttgcatcgtctctattcat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
5395155 |
ttatgcgacttggatttgcacattcatcctttccatcatgttctctcttcactttgtgcttggatctgcagttagcattttcatcgtctctattcat |
5395251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 19 - 81
Target Start/End: Complemental strand, 5430304 - 5430242
Alignment:
| Q |
19 |
tttgtgcatatgggaaaattgcaccattatttattcaccaaaataaaatagttacggaaccaa |
81 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |||| |||||||| ||| |||| ||||| |
|
|
| T |
5430304 |
tttgtgtatatgggaaaattgcaccattatttatccacccaaataaaaaagtaacggcaccaa |
5430242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University