View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11880_low_33 (Length: 272)
Name: NF11880_low_33
Description: NF11880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11880_low_33 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 3 - 267
Target Start/End: Complemental strand, 23176763 - 23176498
Alignment:
| Q |
3 |
gaagcaagggcgtatggccgttgcaagagg-ttattatatcatgggagaacaacagaagtacattaagcaatgagcaaaacatgaggcggcaccttaatc |
101 |
Q |
| |
|
||||||||||||||||| |||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
23176763 |
gaagcaagggcgtatggtcgttgcaagagggttgttatatcatgggagaacaacagaagtacattaagcaatgagcaaaacatgaggtggcaccttaatc |
23176664 |
T |
 |
| Q |
102 |
cattgctcctagaaacactacaggaattttgtgtgcttcgaagccagaagcaaattagaatcatctacgaagctgttgcaacatttttcgtgtgccaaat |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
23176663 |
cattgctcctagaaacactacaggaattttgtgtgcttcgaagccagaagcaaattagaatcatctacgaagctgttgcaacatttttcgtgcgccaaat |
23176564 |
T |
 |
| Q |
202 |
caaaaccggggcaatttagtgtcagccaagcctatgctatgtagtgttgatgtaacctatgcttct |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
23176563 |
caaaaccggggcaatttagtgtcagccaagcctatgctatgtagagttgatgtaacctatgtttct |
23176498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University