View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11880_low_34 (Length: 270)
Name: NF11880_low_34
Description: NF11880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11880_low_34 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 20 - 138
Target Start/End: Complemental strand, 26691431 - 26691313
Alignment:
| Q |
20 |
gagaatcactaatcatgtagctatatttttagtatttgcaactctcattgtttataatacattaatgcttatttttcatattaaattgaagaggatgtac |
119 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26691431 |
gagaatcaccaatcatgtagctatatttttagtatttgcaactctcattgtttataatacattaatgcttatttttcatattaaattgaagaggatgtac |
26691332 |
T |
 |
| Q |
120 |
ttgccctcccttacctata |
138 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
26691331 |
ttgccctcccttacctata |
26691313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 235 - 267
Target Start/End: Complemental strand, 26691217 - 26691185
Alignment:
| Q |
235 |
gatttttcaattattgaaagaatgcattcatct |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
26691217 |
gatttttcaattattgaaagaatgcattcatct |
26691185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University