View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11882_high_22 (Length: 272)
Name: NF11882_high_22
Description: NF11882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11882_high_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 1 - 259
Target Start/End: Complemental strand, 26914924 - 26914666
Alignment:
| Q |
1 |
caaattggtgtatgaannnnnnngatgggacaaagaactgagacatagccaaaaaaggaaccagcaaaaatgacataggacaatattatatagttatatt |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
26914924 |
caaattggtgtatgaatttttttgatgggacaaagaactgagacatagccaaaaaaggaaccagcaaaaatggcataagacaatattatatagttatatt |
26914825 |
T |
 |
| Q |
101 |
ctcccatgataaagcattcgtacatagtagggcaaaaagctactaaacctagcaagttcaaacaaacatcataatcaaatttcattacgaacacaaacat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26914824 |
ctcccatgataaagcattcgtacatagtagggcaaaaagctactaaacctagcaagttcaaacaaacatcataatcaaatttcattacgaacacaaacat |
26914725 |
T |
 |
| Q |
201 |
catagaaaagactaaaccgaaccaaacccgcattcatcggctcaagacgtggtgcatct |
259 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
26914724 |
catagaaaagactaaaccgaaccaaaccctcattcatcggctcaagacgtggtgcatct |
26914666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University