View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11882_low_23 (Length: 284)
Name: NF11882_low_23
Description: NF11882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11882_low_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 135; Significance: 2e-70; HSPs: 8)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 15 - 149
Target Start/End: Complemental strand, 11118527 - 11118393
Alignment:
| Q |
15 |
agcaaaggaagatttaagttgatctagactggagctgggacctggaagatttctattggcaagggattgatttgctgttagactatcccttcttcccaat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11118527 |
agcaaaggaagatttaagttgatctagactggagctgggacctggaagatttctattggcaagggattgatttgctgttagactatcccttcttcccaat |
11118428 |
T |
 |
| Q |
115 |
ggaacgatccaacctggacccccactctgtgaata |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
11118427 |
ggaacgatccaacctggacccccactctgtgaata |
11118393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 15 - 145
Target Start/End: Complemental strand, 11110577 - 11110447
Alignment:
| Q |
15 |
agcaaaggaagatttaagttgatctagactggagctgggacctggaagatttctattggcaagggattgatttgctgttagactatcccttcttcccaat |
114 |
Q |
| |
|
|||||||| |||||||||| ||||||||||| || ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| | | |
|
|
| T |
11110577 |
agcaaaggcagatttaagtcgatctagactgaagttgggacctggaagattttgattggcaagggattgatttgctgttagactatcccttcttcctagt |
11110478 |
T |
 |
| Q |
115 |
ggaacgatccaacctggacccccactctgtg |
145 |
Q |
| |
|
||||| |||||||||||||||| |||||| |
|
|
| T |
11110477 |
ggaacctcccaacctggacccccagtctgtg |
11110447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 15 - 151
Target Start/End: Original strand, 10793748 - 10793884
Alignment:
| Q |
15 |
agcaaaggaagatttaagttgatctagactggagctgggacctggaagatttctattggcaagggattgatttgctgttagactatcccttcttcccaat |
114 |
Q |
| |
|
|||||||||||||||||||||| |||| || || || ||||||||||| ||| || |||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
10793748 |
agcaaaggaagatttaagttgacttagattgaagaaaggggctggaagattttgatttgcgagggttcgatttgctgttagactatcccttcttcccaat |
10793847 |
T |
 |
| Q |
115 |
ggaacgatccaacctggacccccactctgtgaatata |
151 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||| |
|
|
| T |
10793848 |
ggaacgatccaaccgggacctttactctgtgaatata |
10793884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 218 - 262
Target Start/End: Complemental strand, 11118300 - 11118256
Alignment:
| Q |
218 |
tatttaccagaactgaagatactccagctgcaagtgtgagaatat |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11118300 |
tatttaccagaactgaagatactccagctgcaagtgtgagaatat |
11118256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 56 - 118
Target Start/End: Complemental strand, 11097455 - 11097393
Alignment:
| Q |
56 |
ctggaagatttctattggcaagggattgatttgctgttagactatcccttcttcccaatggaa |
118 |
Q |
| |
|
||||||| ||| ||| ||||||| ||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
11097455 |
ctggaaggttttgatttgcaagggcttggtttgctgttaaactatcccttcttcccaatggaa |
11097393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 52 - 116
Target Start/End: Complemental strand, 11172446 - 11172382
Alignment:
| Q |
52 |
ggacctggaagatttctattggcaagggattgatttgctgttagactatcccttcttcccaatgg |
116 |
Q |
| |
|
|||| |||||||||| |||| ||||||| | |||||||||||| |||||| |||||||| ||||| |
|
|
| T |
11172446 |
ggacttggaagatttatattagcaagggttagatttgctgttaaactatctcttcttcctaatgg |
11172382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 190 - 221
Target Start/End: Complemental strand, 11118383 - 11118352
Alignment:
| Q |
190 |
aataaataaaagaagttgattcaaccattatt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
11118383 |
aataaataaaagaagttgattcaaccattatt |
11118352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 73 - 119
Target Start/End: Complemental strand, 11178577 - 11178531
Alignment:
| Q |
73 |
gcaagggattgatttgctgttagactatcccttcttcccaatggaac |
119 |
Q |
| |
|
|||||||| | ||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
11178577 |
gcaagggaattatttgctgttaaactatcccttcttcctaatggaac |
11178531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University