View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11882_low_27 (Length: 256)
Name: NF11882_low_27
Description: NF11882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11882_low_27 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 238; Significance: 1e-132; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 246
Target Start/End: Complemental strand, 52699549 - 52699304
Alignment:
| Q |
1 |
ttgaattcttcgacttgtgtcactgtgcatacactccatctgttactaactgtgtctttttctgttataactgctgctttgtcaaaaaacctgcaaaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52699549 |
ttgaattcttcgacttgtgtcactgtgcatacactccatctgttgctaactgtgtctttttctgttataactgctgctttgtcaaaaaacctgcaaaatt |
52699450 |
T |
|
| Q |
101 |
aatttgctccaatcttatagacccaaataaaactaagactaaattacacttctggttatattaaggtttgacttcgttccctagatactgttttattcaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52699449 |
aatttgctccaatcttatagacccaaataaaactaagactaaattacacttctggttatattaaggtttgacttcgttccctagatactgttttattcaa |
52699350 |
T |
|
| Q |
201 |
ttttagttccttactctacaaacctttgtaactttgaccttctctg |
246 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
52699349 |
ttttagttccttactctacaaaactttgtaactttgaccttctctg |
52699304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 1 - 118
Target Start/End: Complemental strand, 52722845 - 52722728
Alignment:
| Q |
1 |
ttgaattcttcgacttgtgtcactgtgcatacactccatctgttactaactgtgtctttttctgttataactgctgctttgtcaaaaaacctgcaaaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52722845 |
ttgaattcttcgacttgtgtcactgtgcatacactccatctgttgctaactgtgtctttttctgttataactgctgctttgtcaaaaaacctgcaaaatt |
52722746 |
T |
|
| Q |
101 |
aatttgctccaatcttat |
118 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
52722745 |
aatttgctccaatcttat |
52722728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 1 - 118
Target Start/End: Complemental strand, 52713823 - 52713706
Alignment:
| Q |
1 |
ttgaattcttcgacttgtgtcactgtgcatacactccatctgttactaactgtgtctttttctgttataactgctgctttgtcaaaaaacctgcaaaatt |
100 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||| || | |||||| |||||||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
52713823 |
ttgaactcttccacttgtgtcactgtgcatacactccatctgttgctgagtgtgtccttttctgtaataactgctgctttgtcaaaaaatctgcaaaatt |
52713724 |
T |
|
| Q |
101 |
aatttgctccaatcttat |
118 |
Q |
| |
|
|||||||||| ||||||| |
|
|
| T |
52713723 |
aatttgctccgatcttat |
52713706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University