View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11883_high_16 (Length: 207)
Name: NF11883_high_16
Description: NF11883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11883_high_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 1 - 193
Target Start/End: Original strand, 39950533 - 39950724
Alignment:
| Q |
1 |
ctgttcaaccaaagagaaatccgcgggctgttttttcaaattgataacttatgattgttttttcaattgatattcacttaccaaannnnnnnnnngttta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
39950533 |
ctgttcaaccaaagagaaatccgcgggctgttttttgaaattgataagttatgattgttttttcaattgatattcacttaccaa-ttttttttttgttta |
39950631 |
T |
|
| Q |
101 |
tttgcaatgtagtcgacctgaccgaattgtcgccatagctgagaggtttggaatggatccatgggctgtactggacaatgtaagtttcctttg |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
39950632 |
tttgcaatgtagtcgacctgaccgaattgtcgccatagctgagaggtttggaatggatccatgggctgtactggacaatgtaattttcctttg |
39950724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 104; Significance: 5e-52; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 39 - 193
Target Start/End: Original strand, 46401919 - 46402071
Alignment:
| Q |
39 |
aattgataacttatgattgttttttcaattgatattcacttaccaaannnnnnnnnngtttatttgcaatgtagtcgacctgaccgaattgtcgccatag |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
46401919 |
aattgataacttatgattgttttttcaattgatattcacttaccaaagtttttat--gtttatttgcaatgtagtcgacctgaccgaattgttgccatag |
46402016 |
T |
|
| Q |
139 |
ctgagaggtttggaatggatccatgggctgtactggacaatgtaagtttcctttg |
193 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
46402017 |
ctgagaggtttggcatggatccaggggctgtactagacaatgtaagtttcctttg |
46402071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University