View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11883_high_2 (Length: 486)
Name: NF11883_high_2
Description: NF11883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11883_high_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 314; Significance: 1e-177; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 35 - 472
Target Start/End: Complemental strand, 25492705 - 25492265
Alignment:
| Q |
35 |
gttgtgaaaggatcccctggccaatcaggagatggtgctacttttagagatagtagtaaagttgttatgggctgtttctcagcttattttggcattcaag |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
25492705 |
gttgtgaaaggatcccctggccaatcaggagatggtgctatttttagagatagtagtaaagttattatgggctgtttctcagcttattttggctttcaag |
25492606 |
T |
 |
| Q |
135 |
atgtattctttgcccagattactgctgctttgttagctattaagattgctcggagccaaagttggcatagtatttggttgaagtgccactcttctcggca |
234 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||| | |||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
25492605 |
atgtattcttttcccagattactgctgctttgttagctattaagattgctcggaacaaaagttggcatagtcattggttgaagtgccactcttctcggca |
25492506 |
T |
 |
| Q |
235 |
cctttggaacgattggcagaagtgcatttattttacatccacttcgctcttgggtttctc-ttgtatttcaagatggaaactattgtgctaacaaacctt |
333 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| ||||||||| ||||||||| ||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
25492505 |
cctttggaacgattggcagaattgcatttattttacatcctcttcgctctcgggtttctctttgtatttcaagatggaaactattgagccaacaaacctc |
25492406 |
T |
 |
| Q |
334 |
ttttgggtcttttctaaatg-ttttacttgagggaatctaatgcctaactttattaggctaga-nnnnnnnnncgtaataggtttgtacttcctaattat |
431 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
25492405 |
ttttgggtcttttctaaatgtttttacttgagggaatccaatgcctaactttattaggctagattttttttttcgtaataggtttgaacttcctaattat |
25492306 |
T |
 |
| Q |
432 |
tggtttctttagttttctcttcgaagcttggttgatgtcca |
472 |
Q |
| |
|
|||||||||||||||||||||||||| |||| | ||||||| |
|
|
| T |
25492305 |
tggtttctttagttttctcttcgaagtttggattatgtcca |
25492265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University