View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11883_low_10 (Length: 307)
Name: NF11883_low_10
Description: NF11883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11883_low_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 111; Significance: 5e-56; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 1 - 119
Target Start/End: Complemental strand, 29595983 - 29595865
Alignment:
| Q |
1 |
aatcaaacacatactacaacattggtgtcattgaaaggaggtaaatctttttcttaatgtgtttcgtagttagtataaaatctcatctacttagaaccgc |
100 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29595983 |
aatcaaacacatactaaaacattggtgtcattgaaaggaggtaaatctttttcttcatgtgtttcgtagttagtataaaatctcatctacttagaaccgc |
29595884 |
T |
|
| Q |
101 |
aaaactgtctcaaatcttg |
119 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
29595883 |
aaaactgtctcaaatcttg |
29595865 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 188 - 281
Target Start/End: Complemental strand, 29595784 - 29595691
Alignment:
| Q |
188 |
accgaaattactcttgtttgatgaatcgttggatattaaaggtgattataccatttattcaaactttgatttatcacattaaaaaactagaaaa |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29595784 |
accgaaattactcttgtttgatgaatcgttggatattaaaggtgatcgtatcatttattcaaactttgatttatcacattaaaaaactagaaaa |
29595691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University