View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11883_low_4 (Length: 447)
Name: NF11883_low_4
Description: NF11883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11883_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 356; Significance: 0; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 356; E-Value: 0
Query Start/End: Original strand, 58 - 429
Target Start/End: Original strand, 52002002 - 52002373
Alignment:
| Q |
58 |
tgagtggtttctttccttttggatcggaagtgttttcaaagttgtagagttttgtgcgtttagaagaagaggcatcatcggagtcgggttcagttcctct |
157 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
52002002 |
tgagtggtttctttccttttggatcagaagtgttttcaaagttgtagagttttgtgcgtttagaagaagaggcatcatcggagtcgggttccgttcctct |
52002101 |
T |
 |
| Q |
158 |
cttgagaaagggttcatgtggtctttcatctctatgaatatgattgggagattcaggaacatatgttgatggggataaggtaaggattgcaccaatttct |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
52002102 |
cttgagaaagggttcatgtggtctttcatctctatgaatatgattgggagattcaggaacatatgttgatggggctaaggtaaggattgcaccaatttct |
52002201 |
T |
 |
| Q |
258 |
ttgttggaaaaaccgtggccctttagttgttctgtgatagaagttatatcctcaatgggaggggcatcgttgggattgggtgggtccattttctgtttct |
357 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
52002202 |
ttgttggaaaaaccgtggccctttagttgttctgtgatagaagttatatcctcaatgggagggacatcgttgggattgggtgggtccattttctgtttct |
52002301 |
T |
 |
| Q |
358 |
tattcttgttttcccgcgctaaattggttgatcaaaatctactacaatgtgttaaaatatttaattagtttg |
429 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52002302 |
tattcttgttttcccgcgctaaattggttgatcaaaatctactacaatgtgttaaaatatttaattagtttg |
52002373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 248 - 299
Target Start/End: Original strand, 52012165 - 52012216
Alignment:
| Q |
248 |
accaatttctttgttggaaaaaccgtggccctttagttgttctgtgatagaa |
299 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||| ||||||| ||||| |||| |
|
|
| T |
52012165 |
accaatttctttgtcggaaaaaccgtgacccttgagttgttttgtgacagaa |
52012216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University