View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11884_low_1 (Length: 251)
Name: NF11884_low_1
Description: NF11884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11884_low_1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 30815001 - 30815238
Alignment:
| Q |
1 |
ccttcaagaaaaactctgaaccagggacaaccaaggctcaaatatactttctgattcctaaattttttgtaattcaaataaatactttataggacaaaat |
100 |
Q |
| |
|
|||| |||| || ||||| ||| |||||||||||||||||||||||||||| ||||||||||| |||||||||||| |||||||||||||||||| || |
|
|
| T |
30815001 |
cctttaagagaacctctggaccggggacaaccaaggctcaaatatactttccgattcctaaatggtttgtaattcaagtaaatactttataggacaggat |
30815100 |
T |
 |
| Q |
101 |
cgtgtgtgcataaccttcataaataaaatttgtgtgaactgcaaacaaaataaacatctgcaattgagctcgaaatggaccaatctaagtaatgaaataa |
200 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30815101 |
cgtgtgtgcataaacttcataaataaaatttgtgtggactgcaaacaaaataaacatctgcaattgagctcgaaatggaccaatctaagtaatgaaataa |
30815200 |
T |
 |
| Q |
201 |
gtttgtataaagttccaaaaataagcaaaacattgatg |
238 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |
|
|
| T |
30815201 |
gtttacataaagttccaaaaataagcaaaacattgatg |
30815238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University