View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11884_low_2 (Length: 249)
Name: NF11884_low_2
Description: NF11884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11884_low_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 30814765 - 30814528
Alignment:
| Q |
1 |
aagccatggagcaagtgcagaagaagaactaagagaagctcagcgactactcgaacaattaaagaaaaaagcccgcggtgtctctgtaaatgaggttcct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||| ||||||||||||| |
|
|
| T |
30814765 |
aagccatggagcaagtgcagaagaagaactaagagaagctcagcgactactcgaacaattaaagaaaaaagctcgtggtgtctctgcaaatgaggttcct |
30814666 |
T |
|
| Q |
101 |
atgaaggctcttcccgctcctaataataatgcacctgcagcatccaataacccgcagcctgacataccgttgcgtctatcctgaacactttagcagacat |
200 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||||||||| |||| | |||||||||| |||| | |||| |||||| ||| |||||||||||| |
|
|
| T |
30814665 |
atgaaggctcttccctttcctaataataacacacctgcagcatccagtaactcccagcctgacacaccgctacgtcaatcctg-acagtttagcagacat |
30814567 |
T |
|
| Q |
201 |
cctctttcacaacacagcatattttgatgaatgcctatg |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
30814566 |
cctctttcacaacacagcatattttgatgaatccctatg |
30814528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University