View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11885_high_23 (Length: 369)
Name: NF11885_high_23
Description: NF11885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11885_high_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 6 - 293
Target Start/End: Complemental strand, 12805956 - 12805669
Alignment:
| Q |
6 |
agaagcaaaggaagagacaaaatagtgtaaagagaaagagatatgggtatttgtatgggtggacaagtatgttgagtagtattatttatgtagaaaaaac |
105 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12805956 |
agaatcaaaggaagagacaaaatagtgtaaagagaaagagatatgggtatttgtatgggtggacaagtatgttgagtagtattatttatgtagaaaaaac |
12805857 |
T |
 |
| Q |
106 |
atcaaatgattgaggaataaaaagagaggtgtagcaaattttttactcataagtttattgttttcttctcttttatctaaggattgttgctgtctcctta |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12805856 |
atcaaatgattgaggaataaaaagagaggtgtagcaaattttttactcataagtttattgttttcttctcttttatctaaggattgttgctgtctcctta |
12805757 |
T |
 |
| Q |
206 |
gatacaaattcttcttggtgttttctgggtttattctcaaaagcttttttcaaagagacaagaaagcaaggaaaattcaggtcattac |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12805756 |
gatacaaattcttcttggtgttttctgggtttattctcaaaagcttttttcaaagagacaagaaagcaaggaaaattcaggtcattac |
12805669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University