View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11885_high_32 (Length: 308)
Name: NF11885_high_32
Description: NF11885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11885_high_32 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 22 - 291
Target Start/End: Original strand, 48965112 - 48965381
Alignment:
| Q |
22 |
gtcgacacgtccaccgttccaacaaaagttgagcacaattcaccaccatctacacaggcacaaagtgttagggatcaatcatcaggatttgttacaaaga |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48965112 |
gtcgacacgtccaccgttccaacaaaagttgagcacaattcaccaccatctacacaggcacaaagtgttagggatcaatcatcaggatttgttacaaaga |
48965211 |
T |
 |
| Q |
122 |
cattgcaattcctgttgcctctactcatattggcctttgcgtttgctatgcagcactacggaaaaaagaaacaagtcagcgactcataaaacctgaactt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48965212 |
cattgcaattcctgttgcctctactcatattggcctttgcgtatgctatgcagcactacggaaaaaagaaacaagtcagcgactcataaaacctgaactt |
48965311 |
T |
 |
| Q |
222 |
ggagcaacaattattttgtgcatgaatcaaatgcattactctgcccaatacaatgcagggctcttgatgt |
291 |
Q |
| |
|
| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48965312 |
gaagcaacaattattttgtgcatgaatcaaattcattactctgcccaatacaatgcagggctcttgatgt |
48965381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University