View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11885_high_49 (Length: 237)

Name: NF11885_high_49
Description: NF11885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11885_high_49
NF11885_high_49
[»] chr3 (3 HSPs)
chr3 (1-218)||(7675015-7675232)
chr3 (7-186)||(7659420-7659599)
chr3 (7-186)||(7624086-7624265)


Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 7675232 - 7675015
Alignment:
1 gtttcagccaaggttgcaagagattggtgtggtgcagggccaaggtgtggtaagttacctattattggccatggttttggtccaggtgggagtggtagtg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7675232 gtttcagccaaggttgcaagagattggtgtggtgcagggccaaggtgtggtaagttacctattattggccatggttttggtccaggtgggagtggtagtg 7675133  T
101 atgaagttcttgttgcaaacttcaccagacggtatattaagattgataatatgcaactagagaatgcaatgagccatagagacatgatttgtgttgtgtt 200  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7675132 atgaagttcttgttgcaaacttcaccaaacggtatattaagattgataatatgcaactagagaatgcaatgagccatagagacatgatttgtgttgtgtt 7675033  T
201 gtgactacgattatgaag 218  Q
    ||||||| ||||||||||    
7675032 gtgactatgattatgaag 7675015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 7 - 186
Target Start/End: Complemental strand, 7659599 - 7659420
Alignment:
7 gccaaggttgcaagagattggtgtggtgcagggccaaggtgtggtaagttacctattattggccatggttttggtccaggtgggagtggtagtgatgaag 106  Q
    ||||||| ||||| ||| |||||||| ||||| || | |||||| | |||||||||||| ||||||||||||||||||||||| ||||||||||||||||    
7659599 gccaaggctgcaatagactggtgtggggcaggacccaagtgtggcatgttacctattataggccatggttttggtccaggtggaagtggtagtgatgaag 7659500  T
107 ttcttgttgcaaacttcaccagacggtatattaagattgataatatgcaactagagaatgcaatgagccatagagacatg 186  Q
     |||| ||||||| ||||  | ||||||||| | |||  ||||| || ||||||  |||||||||| |||||||||||||    
7659499 atctttttgcaaatttcataaaacggtatatgaggatgcataatgtgaaactagctaatgcaatgaaccatagagacatg 7659420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 7 - 186
Target Start/End: Original strand, 7624086 - 7624265
Alignment:
7 gccaaggttgcaagagattggtgtggtgcagggccaaggtgtggtaagttacctattattggccatggttttggtccaggtgggagtggtagtgatgaag 106  Q
    ||||||| ||||| ||| |||||||| ||||| || | |||||| | |||||||||||| ||||||||||||||||||||||| ||||||||||||||||    
7624086 gccaaggctgcaatagactggtgtggggcaggacccaagtgtggcatgttacctattataggccatggttttggtccaggtggaagtggtagtgatgaag 7624185  T
107 ttcttgttgcaaacttcaccagacggtatattaagattgataatatgcaactagagaatgcaatgagccatagagacatg 186  Q
     |||| ||||||| ||||  | ||||||||| | |||  ||||| || ||||||  | |||||||| |||||||||||||    
7624186 atctttttgcaaatttcataaaacggtatatgaggatgcataatgtgaaactagctattgcaatgaaccatagagacatg 7624265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University