View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11885_high_51 (Length: 234)
Name: NF11885_high_51
Description: NF11885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11885_high_51 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 17 - 220
Target Start/End: Original strand, 33432610 - 33432818
Alignment:
| Q |
17 |
aattttatttatgcttttaatggtactatatatttccttttcattcttttgtgatgagtagttttgcacatattttcataattgtcatgttta-----at |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
33432610 |
aattttatttatgcttttaatggtactatatatttccttttcattcttttgtgatgagtagttttgcacatattttcataattgtcatgtttaatttaat |
33432709 |
T |
 |
| Q |
112 |
tactagtactataactatgactacaaaaacaatatattcaagtgggttgtaatgtccccatagcaatcaaggtaactatttttctaacccttgatttttc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33432710 |
tactagtactataactatgactacaaaaacaatatattcaagtgggttgtaatgtccccatagcaatcaaggtaactatttttctaacccttgatttttc |
33432809 |
T |
 |
| Q |
212 |
tttcctttg |
220 |
Q |
| |
|
||||||||| |
|
|
| T |
33432810 |
tttcctttg |
33432818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University