View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11885_low_45 (Length: 242)
Name: NF11885_low_45
Description: NF11885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11885_low_45 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 12 - 242
Target Start/End: Original strand, 29712302 - 29712532
Alignment:
| Q |
12 |
atcataacaaagagccaaccagtgaatagccccgtttaagaagtgaatagccccatttaagaacggctctactttggaattttcacgggccaggcaataa |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29712302 |
atcataacaaagagccaaccagtgaatagccccatttaagaagtgaatagccccatttaagaacggctctactttggaattttcacgggccaggcaataa |
29712401 |
T |
 |
| Q |
112 |
gagaaataattatcaccctcaatttcgttccacgcatcagctctcaatgagaaaagccctaagcgagttaacttatcataagcattgggatcatatgaca |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29712402 |
gagaaataattatcaccctcaatttcgttccacgcatcagctctcaatgagaaaagccctaagcgagttaacttatcataagcattgggatcatatgaca |
29712501 |
T |
 |
| Q |
212 |
tggaaagcacgaagtaatcatcccttgactc |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
29712502 |
tggaaagcacgaagtaatcatcccttgactc |
29712532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 131 - 166
Target Start/End: Complemental strand, 24340510 - 24340475
Alignment:
| Q |
131 |
caatttcgttccacgcatcagctctcaatgagaaaa |
166 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |
|
|
| T |
24340510 |
caatttcgttccacgcattagctctcaatgagaaaa |
24340475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 131 - 166
Target Start/End: Complemental strand, 24352875 - 24352840
Alignment:
| Q |
131 |
caatttcgttccacgcatcagctctcaatgagaaaa |
166 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |
|
|
| T |
24352875 |
caatttcgttccacgcattagctctcaatgagaaaa |
24352840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 126 - 166
Target Start/End: Complemental strand, 48852797 - 48852757
Alignment:
| Q |
126 |
accctcaatttcgttccacgcatcagctctcaatgagaaaa |
166 |
Q |
| |
|
|||||||||||| ||||| |||| ||||||||||||||||| |
|
|
| T |
48852797 |
accctcaatttctttccatgcattagctctcaatgagaaaa |
48852757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University