View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11885_low_47 (Length: 241)
Name: NF11885_low_47
Description: NF11885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11885_low_47 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 175; Significance: 2e-94; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 8 - 227
Target Start/End: Complemental strand, 33135314 - 33135085
Alignment:
| Q |
8 |
caaagaggatgttgtttcttgttcccactttcatttcttgtgtctcatacttcttgttgtacagatatgttagtggcttaattaaattaagttgatgaca |
107 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
33135314 |
caaagaggatgttatttcttgttcccactttcatttcttgtgtctcatatttcttgttgtacagatatgttaatggcttaattaaattaagttgatgaca |
33135215 |
T |
 |
| Q |
108 |
tgttattatgaatatgctagtgcttttgcacaccgagaaaatgtgtacttacta----------attagattaattcatattgaatgaaaaatttcttgg |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
33135214 |
tgttattatgaatatgctagtgcttttgcacaccgagaaaatgtgtacttactaattatatcatattagattaattcatatttaatgaaaaaattcttgg |
33135115 |
T |
 |
| Q |
198 |
tatcaacagaaacaatttagtttgtttgtg |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
33135114 |
tatcaacagaaacaatttagtttgtttgtg |
33135085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 8 - 63
Target Start/End: Complemental strand, 39182292 - 39182237
Alignment:
| Q |
8 |
caaagaggatgttgtttcttgttcccactttcatttcttgtgtctcatacttcttg |
63 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
39182292 |
caaagaagatgttgtttcttgttcccactttcatttcttgtgtcacatacttcttg |
39182237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 8 - 69
Target Start/End: Complemental strand, 28457475 - 28457415
Alignment:
| Q |
8 |
caaagaggatgttgtttcttgttcccactttcatttcttgtgtctcatacttcttgttgtac |
69 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||||||||||||| | ||||||||||||||| |
|
|
| T |
28457475 |
caaagaagatgttgtttcttgttcccg-tttcatttcttgtgtcacgtacttcttgttgtac |
28457415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 8 - 81
Target Start/End: Complemental strand, 40029330 - 40029257
Alignment:
| Q |
8 |
caaagaggatgttgtttcttgttcccactttcatttcttgtgtctcatacttcttgttgtacagatatgttagt |
81 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40029330 |
caaagagaatgttgtttcttgttcccgctttcatttcttgtgtctcatacttcttgttgtacagatatgttagt |
40029257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University