View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11885_low_54 (Length: 230)
Name: NF11885_low_54
Description: NF11885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11885_low_54 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 6 - 228
Target Start/End: Original strand, 33134663 - 33134885
Alignment:
| Q |
6 |
aggttcaaaccttaaaaagtagaaactaacataactcaataaaatttatgtatatatnnnnnnnnnttgnnnnnnnnnnnngaggggaagttgataatct |
105 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| | | ||||||||||||||||||| |
|
|
| T |
33134663 |
aggttcaaaccttaaaaactagaaactaacataactcaataaaatttatgtatatataaaaaaaaat-gtttttgtttattgaggggaagttgataatct |
33134761 |
T |
 |
| Q |
106 |
tacatatatacaaagaattgatcacaaaataatatgtatatatagttgaaattttatcaggaggataaatttgatttagatgaaggaatca-tgacacaa |
204 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| || |
|
|
| T |
33134762 |
tacctatatacaaagaattgatcacaaaataatatgtatatatagttgaaattttatcaggaggataaatttgatttagatgaaggaatcattgacataa |
33134861 |
T |
 |
| Q |
205 |
aattaactttcaaacaaacttttt |
228 |
Q |
| |
|
||| |||||||||||||||||||| |
|
|
| T |
33134862 |
aatcaactttcaaacaaacttttt |
33134885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University