View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11885_low_55 (Length: 227)
Name: NF11885_low_55
Description: NF11885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11885_low_55 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 106; Significance: 3e-53; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 20 - 158
Target Start/End: Complemental strand, 32210743 - 32210606
Alignment:
| Q |
20 |
aggaaaaggaactatcttttaccaattcnnnnnnnctttctttctagtcttgccaattccagcaatattgtaggacatgtgcaacacataaaaggacaag |
119 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32210743 |
aggaaaaggaactatcttttaccaattctattttt-tttctttctagtcttgccaattctagcaatattgtaggacatgtgcaacacataaaaggacaag |
32210645 |
T |
|
| Q |
120 |
ggacatgtataatactaactcgagggatccagcattttt |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32210644 |
ggacatgtataatactaactcgagggatccagcattttt |
32210606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 170 - 211
Target Start/End: Complemental strand, 32210610 - 32210569
Alignment:
| Q |
170 |
tttttagccacatgaaagcaattagcttagaatagaactttc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32210610 |
tttttagccacatgaaagcaattagcttagaatagaactttc |
32210569 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University