View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11885_low_57 (Length: 222)
Name: NF11885_low_57
Description: NF11885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11885_low_57 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 20 - 204
Target Start/End: Original strand, 42770862 - 42771046
Alignment:
| Q |
20 |
ccccttcacttcaacnnnnnnnctctatcttcttcttctgactcagaatttctcggattcggtaacttgacaaacttggaacctgaactcttcttcaatg |
119 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
42770862 |
ccccttcacttcaactttttttctctatcttcttcttctgactcagaatttctcggattcggtaacttgacaaacttggaacctgaactcttcttcaaag |
42770961 |
T |
 |
| Q |
120 |
aatgagttactcttctcggcgtcagtgacgtttcttcaactttgtgttttcttggtgccatttctccaaaatactctctcactct |
204 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42770962 |
aatgagttactcttctcggtgtcagtgacgtttcttcaactttgtgttttcttggtgccatttctccaaaatactctctcactct |
42771046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University