View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11886_high_8 (Length: 238)
Name: NF11886_high_8
Description: NF11886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11886_high_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 59 - 224
Target Start/End: Original strand, 2531826 - 2531991
Alignment:
| Q |
59 |
ccagtcacagtcaatatgagctttaattataaaatgatgtcgactgttaatgtgaaatcgaatcataacccagcttactgcaacagcacctactttggag |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2531826 |
ccagtcacagtcaatatgagctttaattataaaatgatgtcgactgttaatgtgaaatcgaatcataacccagcttagtgcaacagcacctactttggag |
2531925 |
T |
|
| Q |
159 |
agcattcaagaacggaaattcactatcaatggtattaattcataatcttatttgaacaaactttgt |
224 |
Q |
| |
|
||||||||||||||||||||||||||| || || |||||||||||||||||||||||||||||||| |
|
|
| T |
2531926 |
agcattcaagaacggaaattcactatcgatagtgttaattcataatcttatttgaacaaactttgt |
2531991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 172 - 224
Target Start/End: Complemental strand, 21678811 - 21678759
Alignment:
| Q |
172 |
ggaaattcactatcaatggtattaattcataatcttatttgaacaaactttgt |
224 |
Q |
| |
|
||||||||||| ||||| |||||| ||| || |||||| |||||||||||||| |
|
|
| T |
21678811 |
ggaaattcactctcaatagtattagttcctagtcttatgtgaacaaactttgt |
21678759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University