View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11886_high_8 (Length: 238)

Name: NF11886_high_8
Description: NF11886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11886_high_8
NF11886_high_8
[»] chr5 (1 HSPs)
chr5 (59-224)||(2531826-2531991)
[»] chr4 (1 HSPs)
chr4 (172-224)||(21678759-21678811)


Alignment Details
Target: chr5 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 59 - 224
Target Start/End: Original strand, 2531826 - 2531991
Alignment:
59 ccagtcacagtcaatatgagctttaattataaaatgatgtcgactgttaatgtgaaatcgaatcataacccagcttactgcaacagcacctactttggag 158  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
2531826 ccagtcacagtcaatatgagctttaattataaaatgatgtcgactgttaatgtgaaatcgaatcataacccagcttagtgcaacagcacctactttggag 2531925  T
159 agcattcaagaacggaaattcactatcaatggtattaattcataatcttatttgaacaaactttgt 224  Q
    ||||||||||||||||||||||||||| || || ||||||||||||||||||||||||||||||||    
2531926 agcattcaagaacggaaattcactatcgatagtgttaattcataatcttatttgaacaaactttgt 2531991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 172 - 224
Target Start/End: Complemental strand, 21678811 - 21678759
Alignment:
172 ggaaattcactatcaatggtattaattcataatcttatttgaacaaactttgt 224  Q
    ||||||||||| ||||| |||||| ||| || |||||| ||||||||||||||    
21678811 ggaaattcactctcaatagtattagttcctagtcttatgtgaacaaactttgt 21678759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University