View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11886_low_1 (Length: 595)
Name: NF11886_low_1
Description: NF11886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11886_low_1 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 57; Significance: 2e-23; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 25 - 97
Target Start/End: Original strand, 52002537 - 52002609
Alignment:
| Q |
25 |
gaaaagaagtgacatatggaatatgcttataatacttggttaaggacgaaaaacaaagttcgattgctgatga |
97 |
Q |
| |
|
||||||||| ||| |||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
52002537 |
gaaaagaagagacgtatgcaatatgcttataatacttggttaaggacgaaaaacaaagttcaattgctgatga |
52002609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 18 - 97
Target Start/End: Original strand, 5174727 - 5174806
Alignment:
| Q |
18 |
cacagacgaaaagaagtgacatatggaatatgcttataatacttggttaaggacgaaaaacaaagttcgattgctgatga |
97 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||| ||| ||||||||||| |||||||||| ||| ||||||||||| |
|
|
| T |
5174727 |
cacaaacgaaaagaagtgagatatggaatatgcttattatatttggttaaggatgaaaaacaaacttcaattgctgatga |
5174806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University