View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11887_high_17 (Length: 335)
Name: NF11887_high_17
Description: NF11887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11887_high_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 22 - 315
Target Start/End: Complemental strand, 17117011 - 17116717
Alignment:
| Q |
22 |
ccggcaacgcagaaggcgagaacaaggatgcggcggagacctccgccatgagcttccattagagcgaggtaat-aaccggttcggttttttcgggtggtt |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||| ||||||| |
|
|
| T |
17117011 |
ccggcaacgcagaaggcgagaacaaggatgcggcggagacctccgccatgagcttccattagagcgaggaaatgaaccggttcggtttttttaggtggtt |
17116912 |
T |
|
| Q |
121 |
ggggnnnnnnnatgtgaaccggaacggtgtgaagatcggagaggtgaaggtgtaaagtggggaagtgtagagaaggcgccaagttgttaagtaatgtggt |
220 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17116911 |
ggggtttttttatgtgaaccggaacggtgtgaagatcggagaggtgaaggtgtaaagtggggaagtgtagagaaggcgccaagttgttaagtaatgtggt |
17116812 |
T |
|
| Q |
221 |
gttgtgacacgtggagtgttttgattggttgtgatacgcaattgtgttttttcattggatgtggaaacgcatgccttgttttcacgttttcggtc |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
17116811 |
gttgtgacacgtggagtgttttgattggttgtgatacgcaattgtgttttttcattggatgtggaaacgcatgccttgttttcacgtttttggtc |
17116717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University