View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11887_high_30 (Length: 202)

Name: NF11887_high_30
Description: NF11887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11887_high_30
NF11887_high_30
[»] chr8 (1 HSPs)
chr8 (89-168)||(29474405-29474484)


Alignment Details
Target: chr8 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 89 - 168
Target Start/End: Original strand, 29474405 - 29474484
Alignment:
89 taggaaagaaaggtttggcattcactgttgacaagtgaagttcagagagcatatatgctttgcttcatcattttatggtt 168  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29474405 taggaaagaaaggtttggcattcactgttgacaagtgaagttcagagagcatatatgctttgcttcatcattttatggtt 29474484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University