View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11887_low_22 (Length: 307)
Name: NF11887_low_22
Description: NF11887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11887_low_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 1e-87; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 16 - 179
Target Start/End: Complemental strand, 37028089 - 37027926
Alignment:
| Q |
16 |
cattttactcagtgctggtttagtggaaagcacacatgaaatcgaatagttacgaaattagagtctatatacatagatgatggattcaataataagggca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37028089 |
cattttactcagtgctggtttagtggaaagcacacatgaaatcgaatagttacgaaattagagtctatatacatagatgatggattcaataataagggca |
37027990 |
T |
|
| Q |
116 |
aaggataaaaaaggaggtcatcttctactttctttttcctctaatgcgtagtgatttggaatgg |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37027989 |
aaggataaaaaaggaggtcatcttctactttctttttcctctaatgcgtagtgatttggaatgg |
37027926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 223 - 298
Target Start/End: Complemental strand, 37027882 - 37027807
Alignment:
| Q |
223 |
ggactctgctttcagatattattgagtaatggtgtttcttatagtcttacagcatttcaatggaaggactcatcat |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
37027882 |
ggactctgctttcagatattattgagtaatggtgtttcttatagtcttacagcatttcaatggaaggacccatcat |
37027807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University