View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11887_low_28 (Length: 239)
Name: NF11887_low_28
Description: NF11887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11887_low_28 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 37662906 - 37663128
Alignment:
| Q |
1 |
tatttattcttctgcagcacgagcatcacttaatcagcttttccgaactaataaactccaaagcattctaattaacattgctatgtatgttttacctacg |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
37662906 |
tatttattcttctgcagtacgagcatcacttaatcagcttttccgaactaataaactccaaagcattctaattaacattgctatgtatgttttacctatg |
37663005 |
T |
|
| Q |
101 |
aagggaagagaagcaatctcattgttgcaataatcatgtattccttataaaagacttacagtaaattgatctggacgacgacgttcagatgccaaaaatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37663006 |
aagggaagagaagcaatctcattgttgcaataatcatgtattccttataaaagacttacagtaaattgatctggacgacgacgttcagatgccaaaaatc |
37663105 |
T |
|
| Q |
201 |
gcaatctcattgttgcaataatc |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
37663106 |
gcaatctcattgttgcaataatc |
37663128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 113 - 151
Target Start/End: Original strand, 37663106 - 37663144
Alignment:
| Q |
113 |
gcaatctcattgttgcaataatcatgtattccttataaa |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37663106 |
gcaatctcattgttgcaataatcatgtattccttgtaaa |
37663144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University