View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11887_low_32 (Length: 209)
Name: NF11887_low_32
Description: NF11887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11887_low_32 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 35 - 197
Target Start/End: Original strand, 49134071 - 49134231
Alignment:
| Q |
35 |
atgaatatcacggggttgaaagtgattgaagggaaggggtgaggttgtcttaaatatgaaggaagttactactagattacaatccccttaacattagggg |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49134071 |
atgaatatcacggggttgaaagtgattgaagggaaggggtgaggttgtcttaaatatgaaggaagttactactagattacaatccccttaacattagggg |
49134170 |
T |
 |
| Q |
135 |
attttgttgggttgggtgcgcaaaaggaagagaagagagacaaagaatctacggcctttgctt |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
49134171 |
attttgttgggttgggtgcgcaaaaggaagaga--agagacaaagaatctacggcctttgctt |
49134231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University