View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11888_high_42 (Length: 211)
Name: NF11888_high_42
Description: NF11888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11888_high_42 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 7961046 - 7960849
Alignment:
| Q |
1 |
cacctttcttttgaaaaccgtggcggatgatgttgcaaactccgcatccaggcacagcgcaaagggtggaggaaccacttgcaccgagtgcacacgataa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7961046 |
cacctttcttttgaaaaccgtggcggatgatgttgcaaacaccgcatccaggcacagcgcaaagggtggaggaaccacttgcaccgagtgcacacgataa |
7960947 |
T |
|
| Q |
101 |
cgatgtgctgtggaaacggaggagttcattgccgtccgcggcacaccggggatttttcttggtggtgttggatgcacgggattttactgcgtctctgc |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7960946 |
cgatgtgctgtggaaacggaggagttcattgccgtccgcggcacaccggggatttttcttggtggtgttggatgcacgggattttactgcgtctctgc |
7960849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University