View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11888_low_37 (Length: 256)

Name: NF11888_low_37
Description: NF11888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11888_low_37
NF11888_low_37
[»] chr1 (1 HSPs)
chr1 (19-213)||(27724971-27725169)


Alignment Details
Target: chr1 (Bit Score: 154; Significance: 9e-82; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 19 - 213
Target Start/End: Complemental strand, 27725169 - 27724971
Alignment:
19 caccctgccaacatggttagtttaataaata----ctaactgatttcagttatagaaagagcgttggttagttaagttagttaattaacgttttctgtca 114  Q
    |||||||||||||||||||||| ||||||||    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27725169 caccctgccaacatggttagttaaataaataaatactaactgatttcagttatagaaagagcgttggttagttaagttagttaattaacgttttctgtca 27725070  T
115 catgaattgctcttgcaggcagtggtgctgtttgctatgggtggttatggtacctatctgggttttcgcattcgttattccgatgacgtagtaagctat 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| | ||||||||| || ||| |||||    
27725069 catgaattgctcttgcaggcagtggtgctgtttgctatgggtggttacggtacctatctgggttttcgcattcgattttccgatgatgtggtacgctat 27724971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University