View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11888_low_37 (Length: 256)
Name: NF11888_low_37
Description: NF11888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11888_low_37 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 154; Significance: 9e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 19 - 213
Target Start/End: Complemental strand, 27725169 - 27724971
Alignment:
| Q |
19 |
caccctgccaacatggttagtttaataaata----ctaactgatttcagttatagaaagagcgttggttagttaagttagttaattaacgttttctgtca |
114 |
Q |
| |
|
|||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27725169 |
caccctgccaacatggttagttaaataaataaatactaactgatttcagttatagaaagagcgttggttagttaagttagttaattaacgttttctgtca |
27725070 |
T |
|
| Q |
115 |
catgaattgctcttgcaggcagtggtgctgtttgctatgggtggttatggtacctatctgggttttcgcattcgttattccgatgacgtagtaagctat |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| | ||||||||| || ||| ||||| |
|
|
| T |
27725069 |
catgaattgctcttgcaggcagtggtgctgtttgctatgggtggttacggtacctatctgggttttcgcattcgattttccgatgatgtggtacgctat |
27724971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University