View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11888_low_40 (Length: 239)
Name: NF11888_low_40
Description: NF11888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11888_low_40 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 144; Significance: 8e-76; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 54 - 218
Target Start/End: Original strand, 40925872 - 40926032
Alignment:
| Q |
54 |
aattccgtggcctataaaaaattgaagtctttgctggtcagaatcttttcaaggtggcaggagcagatcaattcaacacttgacttacgtggtgtacgtt |
153 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
40925872 |
aattccgtggcgtataaaaaattgaagtctttgctggtcagaatcttttcaaggtggcaggagcagatcaattcaacacttgacttacgtggt----gtt |
40925967 |
T |
|
| Q |
154 |
gcttttaccctcactacctcaaagccaccgtcttcatcaacaccgaaacaagttgagacatggac |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40925968 |
gcttttaccctcactacctcaaagccaccgtcttcatcaacaccgaaacaagttgagacatggac |
40926032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 55
Target Start/End: Original strand, 40925621 - 40925675
Alignment:
| Q |
1 |
ccttatttgcatgagtccatgtctcaactagccaacttgtttcggtgttgatgaa |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40925621 |
ccttatttgcatgagtccatgtctcaactagccaacttgtttcggtgttgatgaa |
40925675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 40925699 - 40925653
Alignment:
| Q |
162 |
cctcactacctcaaagccaccgtcttcatcaacaccgaaacaagttg |
208 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
40925699 |
cctcactacctcaaacccactttcttcatcaacaccgaaacaagttg |
40925653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 74 - 140
Target Start/End: Original strand, 6716248 - 6716313
Alignment:
| Q |
74 |
attgaagtctttgctggtcagaatcttttcaaggtggcaggagcagatcaattcaacacttgactta |
140 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||| |||||||||| ||| |||||||||||||||||| |
|
|
| T |
6716248 |
attgaagtctttgctggtcagaat-tttcgaagatggcaggagcggattaattcaacacttgactta |
6716313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 162 - 206
Target Start/End: Complemental strand, 6717243 - 6717199
Alignment:
| Q |
162 |
cctcactacctcaaagccaccgtcttcatcaacaccgaaacaagt |
206 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||| |||||||||| |
|
|
| T |
6717243 |
cctcactacctcaaagccaccttcttaatcaacatcgaaacaagt |
6717199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University