View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11888_low_42 (Length: 229)
Name: NF11888_low_42
Description: NF11888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11888_low_42 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 6 - 201
Target Start/End: Complemental strand, 38266554 - 38266359
Alignment:
| Q |
6 |
tcgttacttgttagttggtgcttcaatttgataatttcaaaaactatttgttggatgaatcctccctcaagaagttaatttcctctaaacttacgatagt |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
38266554 |
tcgttacttgttagttggtgcttcaatttgataatttcaaaaactatttgttagatgaatcctccctcaagaagttaatttcctctaaacttaagatagt |
38266455 |
T |
 |
| Q |
106 |
tacaaaaattaaactagaatttggtcaattcgaactcgtaatattttatttgcatgtcatttggtatcatgaatcattttcgcataattcacttat |
201 |
Q |
| |
|
|| |||| ||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38266454 |
tataaaacttaaattagaatttggtcaattcgaactcttaatattttatttgcatgtcatttggtatcatgaatcattttcacataattcacttat |
38266359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University