View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11890_high_16 (Length: 272)
Name: NF11890_high_16
Description: NF11890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11890_high_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 18 - 259
Target Start/End: Complemental strand, 37601627 - 37601389
Alignment:
| Q |
18 |
ctagcaacttagttagaacgggttccttcttgtatgtgaaagttgtaggtaattgattgaatgagcttatttttctttgtttcttgttgtacttgtacta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37601627 |
ctagcaacttagttagaacgggttccttcttgtatgtgaaagttgtaggtaattgattgaatgagcttatttttctttgtttcttgttgtacttgtacta |
37601528 |
T |
|
| Q |
118 |
gctgtttgcgtgcatctatctattttatggtttccaaattccaacgcgcaaaggtttgctgaaaaatatgattgggttttagatgccctttattgcaagt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37601527 |
gctgtttgcgtgcatctatctattttatggtttccaaattccaacgcgcaaaggtttgctgaaaaatatgattgggttttagatgccctttattgcaagt |
37601428 |
T |
|
| Q |
218 |
tactactacaattactacaattggacttccaataatatgcct |
259 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37601427 |
ta---ctacaattactacaattggacttccaataatatgcct |
37601389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University