View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11890_high_18 (Length: 263)
Name: NF11890_high_18
Description: NF11890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11890_high_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 4 - 87
Target Start/End: Complemental strand, 25872505 - 25872417
Alignment:
| Q |
4 |
gtgatgcggaatttgacaaatc--gatttttctat---acgcagtttagtacaaaatggtatcaaacaacaacgctacaagctataaca |
87 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |||| ||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
25872505 |
gtgatgcggaatttgacaaatcacgatttttctatgatacgctgtttagtacaaaatggtttcaaacaacaacgctacaagctataaca |
25872417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University