View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11890_high_22 (Length: 228)
Name: NF11890_high_22
Description: NF11890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11890_high_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 1179811 - 1180024
Alignment:
| Q |
1 |
atcggcgcgtgaacgaaatacggcgcgtggataacatcgtagggagcgtgtaaccgttaggaagaagacgaagctcagaaagagtgagacggcgtggaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1179811 |
atcggcgcgtgaacgaaatacggcgcgtggataacatcgtagggagcgtgtaaccgttaggaagaagacgaagctcagaaagagtgagacggcgtggaat |
1179910 |
T |
 |
| Q |
101 |
gatatgataacggagagtatcggtgtaagacgacgcagtttgcgtcatgtcgagagcgaagagtgaagaatcagtgggagcgaagaaagtgaaagagttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1179911 |
gatatgataacggagagtatcggtgtaagacgacgcagtttgcgtcatgtcgagagcgaagagtgaagaatcagtgggagcgaagaaagtgaaagagttt |
1180010 |
T |
 |
| Q |
201 |
gtggcgtttgaatt |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
1180011 |
gtggcgtttgaatt |
1180024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University