View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11890_low_1 (Length: 1032)
Name: NF11890_low_1
Description: NF11890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11890_low_1 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 95; Significance: 6e-46; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 95; E-Value: 6e-46
Query Start/End: Original strand, 448 - 568
Target Start/End: Complemental strand, 24942119 - 24942002
Alignment:
| Q |
448 |
gcaacatgtaactaatagaacaacatatgtcaatatgctcatatgcgtttttgaagtaactttcctctaaaactcacatagtgactcatccaagtctcta |
547 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
24942119 |
gcaacatgtaactaatagaacaacatatatcaatatgctcatatgcgttttggaagtaactttcctctaaaactcacatagtgacacatccaagtctcta |
24942020 |
T |
 |
| Q |
548 |
tacgtactcaaacaaacacct |
568 |
Q |
| |
|
||| ||||||||||||||| |
|
|
| T |
24942019 |
tac---ctcaaacaaacacct |
24942002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 250 - 283
Target Start/End: Original strand, 20515595 - 20515628
Alignment:
| Q |
250 |
agaagttgaatgattgaagatgcttccagagatg |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
20515595 |
agaagttgaatgattgaagatgcttccagagatg |
20515628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.0000000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 318 - 392
Target Start/End: Original strand, 11299382 - 11299456
Alignment:
| Q |
318 |
atggaggttttggttgagaggaatgaaaggatgtggcagagtatagagtctggtaaggtgcttattctgtcaatg |
392 |
Q |
| |
|
|||| ||||||||||| |||||| || | |||||||||||||| ||||||||||| |||||| |||||||||| |
|
|
| T |
11299382 |
atggtggttttggttgggaggaaggagaagatgtggcagagtacagagtctggtagattgcttagtctgtcaatg |
11299456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 279 - 382
Target Start/End: Original strand, 35189933 - 35190036
Alignment:
| Q |
279 |
agatggcgccagcggcgagaaacgagagagattgttgatatggaggttttggttgagaggaatgaaaggatgtggcagagtatagagtctggtaaggtgc |
378 |
Q |
| |
|
||||||||||| |||||||| ||||||| |||||||| | || | ||||||||| |||||| || || || |||||||| | |||||||||| |||| |
|
|
| T |
35189933 |
agatggcgccaacggcgagagacgagagggattgttgtgacggtgattttggttgggaggaaggagagtatatggcagaggagtgagtctggtagggtgt |
35190032 |
T |
 |
| Q |
379 |
ttat |
382 |
Q |
| |
|
|||| |
|
|
| T |
35190033 |
ttat |
35190036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University