View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11890_low_10 (Length: 368)
Name: NF11890_low_10
Description: NF11890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11890_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 75 - 363
Target Start/End: Original strand, 33713498 - 33713787
Alignment:
| Q |
75 |
tgaatgaatttcatcgcaccgtattaacaaatatattatgcgtatgaatttagnnnnnnnnnnnnn-gcatttacgagatccagtttaatgccaaaagga |
173 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
33713498 |
tgaatgaatttcatcgcaccgtattaacaaatatattatgcgtatgaatttagttttttttttttttgcatttacgagatccagtttaatgccaaaagga |
33713597 |
T |
|
| Q |
174 |
gcattatggatgctaaccaaggtagagtatacaagtcagaagaaaaatacatcgggcgaacggtttgtaactactactatttaactaccattgagagata |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33713598 |
gcattatggatgctaaccaaggtagagtatacaagtcagaagaaaaatacatcgggcgaacggtttgtaactactactatttaactaccattgagagata |
33713697 |
T |
|
| Q |
274 |
tttttggaaattcgaggtgcttgttgtgagcaattgcctagaccttatattttagaaaactttacctcatacccttatgcctatgcttct |
363 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
33713698 |
tttttggaagttcgaggtgcttgttgtgagcaattgcctagaccttatactttagaaaactttacctcatacccttatgcttatgtttct |
33713787 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 23 - 72
Target Start/End: Original strand, 33713424 - 33713473
Alignment:
| Q |
23 |
tactcgaatggagttataaactgttatgattcactcttcgtgctgaccaa |
72 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33713424 |
tactcgaatggagttataaactgttatgattcactcttcgtgctgaccaa |
33713473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University