View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11890_low_15 (Length: 272)
Name: NF11890_low_15
Description: NF11890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11890_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 19 - 265
Target Start/End: Original strand, 688769 - 689033
Alignment:
| Q |
19 |
tagaaggtagctcattttgcataatatttataggaatagctgtcagtatgtatgt--------ttagtagtgattgtattttttgatgag---------- |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
688769 |
tagaaggtagctcattttgcataatatttataggaatagctgtcagtatgtatgtatgtatgtttagtagtgattgtattttttgatgagaaatcaatga |
688868 |
T |
 |
| Q |
101 |
-taattaattagttttaatagtaattttataattaagtttggggatgaaaactatgaattagacggctgcatggtatttgtctttcatcgatcctccggc |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
688869 |
gtaattaattagttttaatagtaattttataattaagtttggggatgaaaactatgaattagacggctgcatggtatt-gtctttcatcgatcctccggc |
688967 |
T |
 |
| Q |
200 |
tcttgttcttgcagttacacaatttcccttttacaagcttattttttgttcatgctgtctctgctt |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
688968 |
tcttgttcttgcagttacacaatttcccttttacaagcttattttttgttcatgctgtctatgctt |
689033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University