View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11890_low_19 (Length: 254)
Name: NF11890_low_19
Description: NF11890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11890_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 14 - 169
Target Start/End: Complemental strand, 50530006 - 50529851
Alignment:
| Q |
14 |
gatacttgcctagattcatgttattttagaagcattatcaccttagcaaactcattgaacatatattctcacatttgaatattagagttagcaaatgtga |
113 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50530006 |
gatacttgcctagattcatgctattttagaagcattatcaccttagcaaactcattgaacatatattctcacatttgaatattagagttagcaaatgtga |
50529907 |
T |
|
| Q |
114 |
aaccaaattcattaacgtgccgatctttgatagaattttataaggttcatttttaa |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50529906 |
aaccaaattcattaacgtgccgatctttgatagaattttataaggttcatttttaa |
50529851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 162 - 241
Target Start/End: Complemental strand, 50529826 - 50529746
Alignment:
| Q |
162 |
atttttaataatattttcttttgaaggagtaata-tataaagctatgtttctagacgagtgtcgctatctatgatttccat |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50529826 |
atttttaataatattttcttttgaaggagtaataatataaagctatgtttctagacgagtgtcgctatctatgatttccat |
50529746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University