View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11890_low_22 (Length: 229)
Name: NF11890_low_22
Description: NF11890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11890_low_22 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 123; Significance: 2e-63; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 99 - 229
Target Start/End: Complemental strand, 33525631 - 33525501
Alignment:
| Q |
99 |
gcataaccatgaaccattttgagaacacagctcttgatgattcgctgtcacgatgagtctcttctacaccaacatgatcgttataatacacttcatcttt |
198 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33525631 |
gcatcaccatgaaccattttgagaacacagctcttgatgattcgctgtcgcgatgagtctcttctacaccaacatgatcgttataatacacttcatcttt |
33525532 |
T |
 |
| Q |
199 |
atcttcatcttcaccatcgtcatcttcttct |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
33525531 |
atcttcatcttcaccatcgtcatcttcttct |
33525501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 33525729 - 33525684
Alignment:
| Q |
1 |
caataatgcatttggaggaggcacagagatttctccatcaccacag |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33525729 |
caataatgcatttggaggaggcacagagatttctccatcaccacag |
33525684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University