View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11890_low_9 (Length: 377)
Name: NF11890_low_9
Description: NF11890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11890_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 145; Significance: 3e-76; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 70 - 234
Target Start/End: Original strand, 8019349 - 8019513
Alignment:
| Q |
70 |
catccaatatttgcctccctttaacgatcgacaatcaacttcaatctggttgctacaagtttcgacaacactttgtgcatataccagaccagtgatatca |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| |||||||| | |
|
|
| T |
8019349 |
catccaatatttgcctccctttaacgatcgacaatcaacttcaatctggttgctacaactttcgacaacactttgtgcatatgccagactagtgatatta |
8019448 |
T |
|
| Q |
170 |
gcctaaaatcatacaattgttaaggactaacaactttcataatcatatgcaattagttaaaacct |
234 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8019449 |
gcctaaaatcatacaatcgttaaggactaacaactttcataatcatatgcaattagttaaaacct |
8019513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 16 - 76
Target Start/End: Original strand, 8019265 - 8019325
Alignment:
| Q |
16 |
acatcatagtccatcttctccataagactacgaaattcattttggacatgaccacatccaa |
76 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8019265 |
acatcatagtccatcttctccataagactacgaaattcattttggacatgaccacatccaa |
8019325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 227 - 282
Target Start/End: Complemental strand, 12217309 - 12217255
Alignment:
| Q |
227 |
taaaacctattacagttagttaaaactaactacctggatagtttgtggaacaagtt |
282 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||| |||||||||||||| |
|
|
| T |
12217309 |
taaaacctattacagttagttacaactaacta-ctagataacttgtggaacaagtt |
12217255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University