View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11891_high_25 (Length: 239)
Name: NF11891_high_25
Description: NF11891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11891_high_25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 14 - 220
Target Start/End: Complemental strand, 45722514 - 45722312
Alignment:
| Q |
14 |
cttagtgtgttgcgggactaatgttgaacgtgcatagcatcaagattttggatgatggacaagagttgacaatattgacaattgatatgaattctttaat |
113 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45722514 |
cttagtgtgttgtgggactaatgttgaacgtgcatagcatcaagattttggatgatggacaagagttgacaatattgacaattgatatgaattctttaat |
45722415 |
T |
|
| Q |
114 |
ggcttccacacgcatgtaggaataatttatttatatcaaaatagtaaagttgtactcactactagtagattaaaagcaaattatatttgaatattatgag |
213 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45722414 |
ggcttccacacgcatgtaggaataat----ttatatcaaaatagtgaagttgtactcactactagtagattaaaagcaaattatatttgaatattatgag |
45722319 |
T |
|
| Q |
214 |
taatgga |
220 |
Q |
| |
|
||||||| |
|
|
| T |
45722318 |
taatgga |
45722312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University