View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11891_high_29 (Length: 225)
Name: NF11891_high_29
Description: NF11891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11891_high_29 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 5 - 208
Target Start/End: Original strand, 37059485 - 37059688
Alignment:
| Q |
5 |
gtggaggagcagagaggcggcggacacggcttcacgtttttgggataaacccttgacttgaggcggcggaggaacttggaattttgtttctctcatggaa |
104 |
Q |
| |
|
|||||||| | | |||||||||||||| |||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
37059485 |
gtggaggaactgggaggcggcggacacagcttcacgtttttgggataaacccttaacttgaggcggcggtggaacttggaattttgtttctctcatggaa |
37059584 |
T |
 |
| Q |
105 |
ggaagaagatgatgatgagatgaaattagggtttcttgggcttgggttagcttgctggactattaatattggcctttgacttgggttaataaagttggac |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
37059585 |
ggaagaagatgatgatgagatgaaattagggtttcttgggcttgggttagcttgctggactattaatattgggctttgacttgggttaataaagttggac |
37059684 |
T |
 |
| Q |
205 |
tatg |
208 |
Q |
| |
|
|||| |
|
|
| T |
37059685 |
tatg |
37059688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 88 - 206
Target Start/End: Complemental strand, 15424881 - 15424761
Alignment:
| Q |
88 |
ttgtttctctcatggaaggaagaagatgatgatgagatgaaattagggtttcttgggcttgggttagcttgctggac--tattaatattggcctttgact |
185 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||| |||| |||||||||||| ||||| || |
|
|
| T |
15424881 |
ttgtttctctcttggaaggaagaagatgatgatcagatgaaattatggtttcttgggcttgggttagcttgcaggactatattaatattgggctttggct |
15424782 |
T |
 |
| Q |
186 |
tgggttaataaagttggacta |
206 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
15424781 |
tgggttaataaagttggacta |
15424761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 103 - 142
Target Start/End: Original strand, 27259094 - 27259133
Alignment:
| Q |
103 |
aaggaagaagatgatgatgagatgaaattagggtttcttg |
142 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
27259094 |
aaggaggaagatgacgatgagatgaaattagggtttcttg |
27259133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 140 - 199
Target Start/End: Original strand, 27259150 - 27259211
Alignment:
| Q |
140 |
ttgggcttgggttagcttgctggactat--taatattggcctttgacttgggttaataaagt |
199 |
Q |
| |
|
||||| ||||||||||||| |||||||| ||||||||| ||||||||||||| ||||||| |
|
|
| T |
27259150 |
ttgggtttgggttagcttgttggactatattaatattgggttttgacttgggttgataaagt |
27259211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University