View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11891_low_21 (Length: 306)
Name: NF11891_low_21
Description: NF11891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11891_low_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 1 - 289
Target Start/End: Original strand, 53435105 - 53435393
Alignment:
| Q |
1 |
ttaggcattaagaatttatgttattcttgtgttattatagaagctaactatagggcgattttacaagctaattaacgttattttatccattaatttcttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
53435105 |
ttaggcattaagaatttatgttattcttgtgttattatagaagctaactatagggcaattttacaacctaattaacgttattttatccattaatttcttt |
53435204 |
T |
 |
| Q |
101 |
gattgggcacaacagttttgatatttttctttctttgagcattttaataggtgattataatgtatagagccgtagcttgccgtggttgagtttgtaattt |
200 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53435205 |
gattgggtacaacagttttgatatttttctttctttgagcattttaataggtgattataatgtatagagccgtagcttgccgtggttgagtttgtaattt |
53435304 |
T |
 |
| Q |
201 |
tatctttcttttcatcaataataatataaagtgaaattaaaaatcaaaatgttttggtggaattaatgcatgcgcattgcaggtatata |
289 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
53435305 |
tatctttcttttcatcaataataacataaagtgaaattaaaaatcaaaatgttttggtggaattaatgcatgcgcattgctggtatata |
53435393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University