View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11891_low_23 (Length: 296)
Name: NF11891_low_23
Description: NF11891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11891_low_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 16 - 285
Target Start/End: Complemental strand, 34492099 - 34491829
Alignment:
| Q |
16 |
atttatatgcaaaagctatccctactagccaaatggcgtggcttacaacatctaacctatattggttaatttcgtgggtagtgcatgagttgtcctcgtt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
34492099 |
atttatatgcaaaagctatccctactagccaaatgacgtggcttacaacatctaacctatattggttaatttagtgggtagtgcatgagttttcctcgtt |
34492000 |
T |
 |
| Q |
116 |
gacggggtcatggtgccctaagttcgactcttggattcctccatcatgacttggtctttagtgtgcatgagttttcctcgttgaggggatcatggtg-tc |
214 |
Q |
| |
|
|| ||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
34491999 |
gagggggtcatggtgccctatgttcgactcttggattcctccatcatgactcggtctttagtgtgcatgagttttcctcgttgaggggatcatggtgccc |
34491900 |
T |
 |
| Q |
215 |
taagttcaactcttagcttcctccatcatgacatggtctttagtttgtagctctccaagaacgtgattcat |
285 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
34491899 |
taagttcgactcttagcttcctccatcatgacatggtttttagtttgtagctctccaagaacgtgattcat |
34491829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University