View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11891_low_30 (Length: 239)

Name: NF11891_low_30
Description: NF11891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11891_low_30
NF11891_low_30
[»] chr4 (1 HSPs)
chr4 (14-220)||(45722312-45722514)


Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 14 - 220
Target Start/End: Complemental strand, 45722514 - 45722312
Alignment:
14 cttagtgtgttgcgggactaatgttgaacgtgcatagcatcaagattttggatgatggacaagagttgacaatattgacaattgatatgaattctttaat 113  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45722514 cttagtgtgttgtgggactaatgttgaacgtgcatagcatcaagattttggatgatggacaagagttgacaatattgacaattgatatgaattctttaat 45722415  T
114 ggcttccacacgcatgtaggaataatttatttatatcaaaatagtaaagttgtactcactactagtagattaaaagcaaattatatttgaatattatgag 213  Q
    ||||||||||||||||||||||||||    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45722414 ggcttccacacgcatgtaggaataat----ttatatcaaaatagtgaagttgtactcactactagtagattaaaagcaaattatatttgaatattatgag 45722319  T
214 taatgga 220  Q
    |||||||    
45722318 taatgga 45722312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University