View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11892_low_23 (Length: 348)
Name: NF11892_low_23
Description: NF11892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11892_low_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 63 - 332
Target Start/End: Original strand, 17682339 - 17682608
Alignment:
| Q |
63 |
ggaaggaggggtggttcccattttgaagttgatgaaagaagggaacacacaagaaggaaaacaaactgctgcaagagccatcgctcttttcgtttctgac |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
17682339 |
ggaaggaggggtggttcccattttgaagttgatgaaagaagggaacacaaaagaaggaaaacaaactgctgcaagagccattgctcttttcgtttctgac |
17682438 |
T |
 |
| Q |
163 |
atagcagcggacaagcacgttgtctccttcatttgcgaacaaatttccatccttcgtactgactcgttggatgatcattctgatgcagccgcatccctcg |
262 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
17682439 |
atagcagcggacaagcaagttgtctccttcatttgcgaacaaatttccatccttcatactgactcgttggaggatcgttctgatgcagccgcatccctcg |
17682538 |
T |
 |
| Q |
263 |
tatttctagcaaatgaaagccaccgttacggggagatgattatcgagaaaggaggggtggggctcctttt |
332 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||||||| ||||| ||||||| || |||| |||||| |
|
|
| T |
17682539 |
tatttctagcaaatgaaagcgaccgttatggggagatgatcatcgaagaaggaggagtagggcccctttt |
17682608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 98 - 286
Target Start/End: Original strand, 17665903 - 17666092
Alignment:
| Q |
98 |
aagaagggaacacacaagaaggaaaacaaactgctgcaagagccatcgctcttttcgtttctgacata-gcagcggacaagcacgttgtctccttcattt |
196 |
Q |
| |
|
||||||| |||||||||||||| ||||| | |||| |||||||||| ||| | |||| || ||||| || || ||| | | |||||||||| |||| |
|
|
| T |
17665903 |
aagaaggaaacacacaagaaggcaaacagaatgcttcaagagccattgctttcttcgactccaacataagccgcagacggacccattgtctcctttattt |
17666002 |
T |
 |
| Q |
197 |
gcgaacaaatttccatccttcgtactgactcgttggatgatcattctgatgcagccgcatccctcgtatttctagcaaatgaaagccacc |
286 |
Q |
| |
|
| |||| ||||||||||||||||| |||||| || ||| |||||| || || ||||||||||| || || ||| |||||||||||| |
|
|
| T |
17666003 |
gtgaactgatttccatccttcgtaccgactcgccagaggattgttctgacgccgctgcatccctcgtgttactggcacatgaaagccacc |
17666092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 185 - 221
Target Start/End: Complemental strand, 17699170 - 17699134
Alignment:
| Q |
185 |
tctccttcatttgcgaacaaatttccatccttcgtac |
221 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
17699170 |
tctccttcatttgtgaactaatttccatccttcgtac |
17699134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University