View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11892_low_27 (Length: 322)
Name: NF11892_low_27
Description: NF11892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11892_low_27 |
 | |
|
| [»] scaffold1524 (1 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 17 - 313
Target Start/End: Complemental strand, 13998080 - 13997781
Alignment:
| Q |
17 |
ggattctcacattcattcatgaatacgcacgtgatcacccctaacctcaacaccacccttcttcatcatcatcatcat---gtgcatggtttaacgaatt |
113 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
13998080 |
ggattctcatattcattcatgaatacgcacgtgatcacccctaacctcaacaccacccttcttcatcatcatcatcatcatgtgcatggtttaacgaatt |
13997981 |
T |
|
| Q |
114 |
cttcacaccgttactccaaaaccaaccatcgtctcttccattcattcaaagtctctaataacgttcgtgtcttttcagagctgaagagtcaaaacaaaat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13997980 |
cttcacaccgttactccaaaaccaaccatcgtctcttccattcattcaaagtctctaataacgttcgtgtcttttcagagctgaagagtcaaaacaaaat |
13997881 |
T |
|
| Q |
214 |
tgattacaatgatcctgattggaaagataagtttaaagaagattttgaggcacggtttagactccctcatgttactgatattttccctgatgcttcttct |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
13997880 |
tgattacaatgatcctgattggaaagataagtttaaagaagattttgaggcacggtttagactccctcatattactgatattttccctgatgcttcttct |
13997781 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 72; Significance: 1e-32; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 228 - 311
Target Start/End: Original strand, 28327293 - 28327376
Alignment:
| Q |
228 |
ctgattggaaagataagtttaaagaagattttgaggcacggtttagactccctcatgttactgatattttccctgatgcttctt |
311 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28327293 |
ctgattggaaaactaagttaaaagaagattttgaggcacggtttagactccctcatgttactgatattttccctgatgcttctt |
28327376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 273 - 311
Target Start/End: Original strand, 28331217 - 28331255
Alignment:
| Q |
273 |
gactccctcatgttactgatattttccctgatgcttctt |
311 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
28331217 |
gactccctcatgtcactgatattttccctgatgcttctt |
28331255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1524 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: scaffold1524
Description:
Target: scaffold1524; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 273 - 311
Target Start/End: Original strand, 291 - 329
Alignment:
| Q |
273 |
gactccctcatgttactgatattttccctgatgcttctt |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
291 |
gactccctcatgttactgatattttccctgatgcttctt |
329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University