View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11892_low_29 (Length: 293)
Name: NF11892_low_29
Description: NF11892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11892_low_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 102; Significance: 1e-50; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 17 - 126
Target Start/End: Complemental strand, 21213606 - 21213497
Alignment:
| Q |
17 |
aatgtatattgggtcttcttcaagatgcaggccttcttggtgctaaactttgttctactccaatggaacctcaacttcaattgcataaatcttctggtga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
21213606 |
aatgtatattgggtcttcttcaagatgcaggccttcttggtgctaaaccttgttctactccaatgaaacctcaacttcaattgcataaatcttctggtga |
21213507 |
T |
 |
| Q |
117 |
actattgtct |
126 |
Q |
| |
|
|||||||||| |
|
|
| T |
21213506 |
actattgtct |
21213497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 183 - 267
Target Start/End: Complemental strand, 21213325 - 21213241
Alignment:
| Q |
183 |
ggtattttctttagtgcatcttcttctttaactctcaaaggtttctctgactcggattgtggagcttatcctggtacaagaagat |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| ||||| | ||||||||| |
|
|
| T |
21213325 |
ggtattttctttagtgcatcttcttctttaactcttaaaggtttctctgactcatattgtggagcttctcctgatgcaagaagat |
21213241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 124 - 185
Target Start/End: Complemental strand, 21213430 - 21213369
Alignment:
| Q |
124 |
tcttatgcagtaagcaagctttgtcggtttttggatgctcgaaggactaaacatatgttggt |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
21213430 |
tcttatgcagtaagcaagctttgtcggtttttggatgctccaaggactaaacatgtgttggt |
21213369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 196 - 288
Target Start/End: Complemental strand, 20843968 - 20843876
Alignment:
| Q |
196 |
gtgcatcttcttctttaactctcaaaggtttctctgactcggattgtggagcttatcctggtacaagaagatccactacatgcctttgcttct |
288 |
Q |
| |
|
|||||| ||| ||||||||||| |||||||||||||| || ||||||||| | | ||||| || ||||||||| ||||||||| |||| |||| |
|
|
| T |
20843968 |
gtgcatgttcctctttaactctgaaaggtttctctgattcagattgtggaccctctcctgatagaagaagatctactacatgcttttgtttct |
20843876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 30 - 101
Target Start/End: Original strand, 46654692 - 46654763
Alignment:
| Q |
30 |
tcttcttcaagatgcaggccttcttggtgctaaactttgttctactccaatggaacctcaacttcaattgca |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| || ||||||||||||||||| ||||||||||| |
|
|
| T |
46654692 |
tcttcttcaagatgcaggccttcttggtgctaaaccttgctccactccaatggaacctcaccttcaattgca |
46654763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University